Skip to main content
Chapter 5 of 13
NCERT Solutions

Molecular Basis of Inheritance

CBSE · Class 12 · Biology

NCERT Solutions for Molecular Basis of Inheritance — CBSE Class 12 Biology.

44 questions88 flashcards5 concepts

Interactive on Super Tutor

Studying Molecular Basis of Inheritance? Get the full interactive chapter.

Quizzes, flashcards, AI doubt-solver and a step-by-step study plan — built for ncert solutions and more.

1,000+ Class 12 students started this chapter today

A labeled diagram illustrating the Watson and Crick model of DNA, showing the double helical structure, antiparallel strands, sugar-phosphate backbone, nitrogenous base pairing (A-T, G-C) with hydroge
Super Tutor

This is just one of 22+ visuals inside Super Tutor's Molecular Basis of Inheritance chapter

Explore the full set
21 Questions Solved · 1 Section

11 worked solutions below. Unlock all 21 free in Super Tutor

EXERCISES

1Group the following as nitrogenous bases and nucleosides:
Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Show solution
A nitrogenous base is the base part only, while a nucleoside is a base linked to a sugar. From the list:

- Bases: Adenine, Thymine, Uracil, Cytosine
- Nucleosides: Cytidine, Guanosine

Not sure why a step works? check your working in Super Tutor

2If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.Show solution
In double-stranded DNA, A pairs with T and G pairs with C.

Given C = 20%, so G = 20%.

Thus, C+G=40%C+G=40\%.

Remaining percentage for A and T = 100%40%=60%100\% - 40\% = 60\%.

Since A = T,

A=60%/2=30%A = 60\%/2 = 30\%.

Not sure why a step works? check your working in Super Tutor

3If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'-8' direction.
Show solution
The complementary strand follows base pairing: A–T and G–C.

Given strand:
5ATGCATGCATGCATGCATGCATGC35'-ATGCATGCATGCATGCATGCATGC-3'

So the complementary strand is antiparallel:
3TACGTACGTACGTACGTACGTACG53'-TACGTACGTACGTACGTACGTACG-5'

Written in 5'→3' direction, it becomes:
5CGTACGTACGTACGTACGTACGTA35'-CGTACGTACGTACGTACGTACGTA-3'.

The question asks for the complementary strand in 5'-3' direction.

Not sure why a step works? check your working in Super Tutor

4If the sequence of the coding strand in a transcription unit is written as follows:
5'-ATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of mRNA.
Show solution
In a transcription unit, the mRNA sequence is complementary to the template strand and therefore same as the coding strand except that U replaces T.

Coding strand given:
5ATGCATGCATGCATGCATGCATGC35'-ATGCATGCATGCATGCATGCATGC-3'

So mRNA is:
5AUGCAUGCAUGCAUGCAUGCAUGC35'-AUGCAUGCAUGCAUGCAUGCAUGC-3'

Not sure why a step works? check your working in Super Tutor

5Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.Show solution
The property was complementary base pairing in the DNA double helix.

Watson and Crick proposed that the two strands are held together by specific hydrogen bonding between complementary bases: A pairs with T and G pairs with C. Because of this, if the two strands separate, each strand can serve as a template for the formation of a new complementary strand. Therefore, after replication, each daughter DNA molecule contains one parental strand and one newly synthesised strand, which is the semi-conservative mode of replication.

Not sure why a step works? check your working in Super Tutor

6Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases.Show solution
Based on the template and product:

- DNA → DNA : DNA-dependent DNA polymerase
- DNA → RNA : DNA-dependent RNA polymerase

These are the nucleic acid polymerases discussed in the chapter.

Not sure why a step works? check your working in Super Tutor

7How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?Show solution
Hershey and Chase used radioactive labeling to distinguish DNA from protein in bacteriophages:

- Viruses grown in **32P^{32}P contained radioactive DNA, because DNA has phosphorus.
- Viruses grown in
35S^{35}S contained radioactive protein, because proteins contain sulfur but DNA does not.

They let these phages infect
E. coli, then used a blender to remove the viral coats from the bacterial cells and a centrifuge to separate the bacterial pellet from the phage coats.

The bacteria infected with
32P^{32}P-labeled phages were radioactive, showing that DNA entered the bacteria. The bacteria infected with 35S^{35}S-labeled phages were not radioactive, showing that protein did not enter**. Thus, DNA was identified as the genetic material.

Not sure why a step works? check your working in Super Tutor

8(a)Repetitive DNA and Satellite DNAShow solution
Repetitive DNA refers to DNA sequences in which a short stretch is repeated many times.

Satellite DNA refers to these repetitive sequences when they separate as distinct minor peaks from the bulk genomic DNA during density gradient centrifugation.

So, repetitive DNA is the sequence type, while satellite DNA is the fraction/peak obtained on centrifugation.

Not sure why a step works? check your working in Super Tutor

8(b)mRNA and tRNAShow solution
mRNA acts as the template for translation.

tRNA carries specific amino acids to the ribosome and has an anticodon that reads the codon on mRNA.

Thus, mRNA carries the message, while tRNA serves as the adapter molecule.

Not sure why a step works? check your working in Super Tutor

8(c)Template strand and Coding strandShow solution
The template strand is the DNA strand with 3'→5' polarity that is read by RNA polymerase to synthesize RNA.

The coding strand has 5'→3' polarity and its sequence is the same as the RNA transcript except that T is present instead of U. It does not serve as the template.

Not sure why a step works? check your working in Super Tutor

9List two essential roles of ribosome during translation.Show solution
The ribosome has two essential roles during translation:

1. It binds the mRNA and positions the tRNAs correctly so amino acids can be added in order.
2. It catalyses peptide bond formation; in bacteria, 23S rRNA acts as the ribozyme for this reaction.

Not sure why a step works? check your working in Super Tutor

10In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
11(a)Promoter
11(b)tRNA
11(c)Exons
12Why is the Human Genome project called a mega project?
13What is DNA fingerprinting? Mention its application.
14(a)Transcription
14(b)Polymorphism
14(c)Translation
14(d)Bioinformatics

10 more solved questions in Molecular Basis of Inheritance

Every remaining exercise is solved step by step in Super Tutor, plus practice quizzes and flashcards for this chapter. Free to start.

Stuck on a step?

Ask Super Tutor AI to explain any solution on this page in a simpler way — free, 24x7.

Ask a Doubt Free

Frequently Asked Questions

What are the important topics in Molecular Basis of Inheritance for CBSE Class 12 Biology?
Molecular Basis of Inheritance covers several key topics that are frequently asked in CBSE Class 12 board exams. Focus on the core concepts listed on this page and practise related questions to build confidence.
How to score full marks in Molecular Basis of Inheritance — CBSE Class 12 Biology?
Understand the core concepts first, then work through the 44 practice questions available for this chapter. Revise formulas and definitions regularly, and use flashcards for quick recall before the exam.
Where can I get free NCERT Solutions for Molecular Basis of Inheritance Class 12 Biology?
This page has free step-by-step NCERT Solutions for every exercise question in Molecular Basis of Inheritance (CBSE Class 12 Biology) — written the way examiners award marks: given, formula, working, answer.

Sources & Official References

Content is aligned to the official syllabus. Refer to the board website for the latest curriculum.

For serious students

Get the full Molecular Basis of Inheritance chapter — for free.

Quizzes, flashcards, AI doubt-solver and a step-by-step study plan for CBSE Class 12 Biology.